MCQ
A clove represents a:
  • A
    Terminal bud
  • B
    Accessory bud
  • C
    Flower bud
  • D
    Vegetative bud

Answer

  1. Flower bud

Explanation:

Cloves represent the flower bud. They are aromatic.

They are flower buds of a tree Syzygium aromaticum belonging to the family Myrtaceae.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Similar questions

Given below are two statements :

Statement $I:$Autoimmune disorder is a condition where body defense mechanism recognizes its own cells as foreign bodies.

Statement $II:$Rheumatoid arthritis is a condition where body does not attack self cells.

In the light of the above statements, choose the most appropriate answer from the options given below:

$RNA$ interference involves
How many billions of base are found in the largest gene dystrophin of human being?
In 1953 S. L. Miller created primitive earth conditions in the laboratory and gave experimental evidence for origin of first form of life from preexisting non-living organic molecules. The primitive earth conditions created include:
Disorder inherited as Mendel's law of inheritance called
In $pBR322$, codes for the proteins involved inthe replication of the plasmid.
Choose correct pair :
Column $- I$ Column $- II$
$(A)$ Myometrium $(1)$ Cushion of fatty tissue
$(B)$ Mons pubis $(2)$ Tiny finger like structure
$(C)$ Acrosome $(3)$ External layer of uterus
$(D)$ Prostate gland $(4)$ Middle thick layer of uterus
$(5)$ Help in fertilization of ovum
Choose the correct sentences from options,

$(1)$ Decomposition is largely an oxygen -requiring process.

$(2)$ Warm and moist environment slow down decomposition process.

$(3)$ Decomposition rate is slower if detritus is rich in lignin and chitin

$(4)$ Humus is colloidal in nature it serves as are servoir of nutrients.

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
Predators play important role in