Organisms and Populations — BIOLOGY STD 12 Science — Question

Choose the correct option for $A, B$ and $C$

$R$ : $DNA$ fragments are negatively charged molecules.

$3$'$TACATGGCAAATATCCATTCA5'$

$(a)\; DNA$ is negatively charged molecule and so it is loaded on gel towards the Anode terminal

$(b) \;DNA$ fragments travel along the surface of the gel whose concentration does not affect movement of $DNA.$

$(c)$ Smaller the size of $DNA$ fragment larger is the distance it travels through it.

$(d)$ Pure $DNA$ can be visualized directly by exposing UV radiation.

Choose correct answer from the options given below