Assertion: hnRNA is subjected to a processing called splicing, ca… - Vidyadip

MCQ

Assertion: hnRNA is subjected to a processing called splicing, capping and tailing.
Reason: In eukaryotes, the primary transcripts called hnRNA is non-functional.

✓
Assertion and reason both are true and the reason is correct explanation of assertion.
B
Assertion and reason both are true but reason is not correct explanation of assertion.
C
Assertion is true but reason is wrong.
D
Assertion and reason both are wrong.

✓

Answer

Correct option: A.

Assertion and reason both are true and the reason is correct explanation of assertion.

A

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

NEET STD 11 Science question papers→Gujarat Board STD 11 Science question papers→Gujarat Board question paper generator→

Similar questions

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

The roots of sequoia are generally...

Choose the correct statement about liverworts

$I.$ In liverworts sexual reproduction occurs by the fusion of antherozoids and egg, which are produced in anthridium and archegonium, respectively

$II$. Both male and female sex organs may be present on same thalli or different thalli

$III.$ Zygote give rise to sporophyte, which is differentiated into food, seta and capsule

$IV$. Some cells of capsule undergoes meiosis and give rise to haploid spores

Reproduction occurs through fragmentation in

Liquid endosperm in coconut is example of ...........

In pteridophytes, the megaspore germinates to form

How many sentence are correct?

$(1)$ The trophic levels in $GFC$ are unlimited

$(2)$ Organisms at each trophic level depend on those at the higher trophic level for their energy demands.

$(3)$ Plants capture only $2 -10$ percent of $PAR$.

$(4)$ All organisms are dependent for their food on producers, either directly or indirectly.

Nomenclature is governed by certain universal rules. Which one of the following is contrary to the rules of nomenclature?

Statement I: Movement of protons across the thylakoid membrane to the stroma occurs through the transmembrane channel of the CF₀ of the ATP synthase
Statement II: The breakdown of the gradient provides enough energy to cause a conformational change in the CF₀ particle of the ATP synthase

Which is correct for centriole function in animal cell?

$(I)$ Formation bipolar spindle

$(II)$ Formation of lysosome

$(III)$ Formation of mesosome

$(IV)$ Formation of ribosome