MCQ
Bacteria commonly reproduce vegetatively by
  • Binary fission
  • B
    Budding
  • C
    Conjugation
  • D
    Oidia

Answer

Correct option: A.
Binary fission
a
It's Obvious

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Similar questions

$A-$ Glycolysis involves only catabolic process.

$R-$ Amphibolic pathway involves both catabolic anabolic process.

Which of the following statements are incorrect ?
(i) Watson and Crick along with Wilkins and Franklin got the Nobel Prize for his work in 1962.
(ii) In RNA, every nucleotide residue has an additional-OH group present at 3'-position in the ribose.
(iii) 5-methyl uracil is an another chemical name for Thymine.
(iv) DNA as an acidic substance present in nucleus was first identified by Friedrich Meischer in 1869 and called it "Nuclein".
(v) In 1953 Watson and Crick, proposed double helix model for the structure of DNA.
(vi) Watson and Crick model is based on the X-ray diffraction data produced by Wilkins and Franklin.
(vii) According to Chargaff the ratio between Adenine and Guanine, Thymine and Cytosine are constant and equals to 1.
Which statement is correct for photosynthesis regarding light ?
(i) There is a linear relationship between incident light and CO2 fixation rates at low light intensities
(ii) At higher light intensities, gradually the rate does not show further increase as other factors become limiting
(iii) Light saturation occurs at 10 per cent of the full sunlight. Hence, except for plants in shade or in dense forests, light is rarely a limiting factor in nature
(iv) Increase in incident light beyond a point causes the breakdown of chlorophyll and a decrease in photosynthesis
(v) When light intensity increase than first rate of photosynthesis increase then becomes constant due to CO2 becomes limiting factor
Transforming principle in Griffith’s experiment was $DNA$. It was discovered by
Which one of the following structures is haploid in its ploidy level :
In a vascular bundle, if xylem vessels develop in a centripetal fashion, the xylem is likely to be
In $C_4$ plants mesophyll cells are connected with bundle sheath cells with the help of
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

Which of the following should be chosen for best yield if one has to produce a recombinant protein or enzyme on a large scale, using microbial plants/animal/human cell?
Number of flagella present in the gametes of Ulothrix is