Download App

Biodiversity and Conservation — BIOLOGY STD 12 Science — Question

Bihar BoardEnglish MediumSTD 12 ScienceBIOLOGYBiodiversity and Conservation1 Mark
MCQ
Biodiversity describes the study of diversity:
  • A
    Below species level.
  • B
    At species level.
  • C
    At community level.
  • D
    At all levels of biological organization.
✓

Answer

  1. At all levels of biological organization.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "M.C.Q [1M]" from Biodiversity and Conservation→Biodiversity and Conservation — all question types→BIOLOGY STD 12 Science question papers→Bihar Board STD 12 Science question papers→Bihar Board question paper generator→

Similar questions

Animals that can tolerate a narrow range of salinity are:
→
Which one of the following is related with genetic engineering?
→
Mendel was successful in discovering the principles of inheritance as
→
Fruit of coconut is:
→
Producing a giant mouse in the laboratory was possible through.
→
Which of the following is first restrictionendonuclease?
→
Bacterial disease is
→
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
→
The effect of today's radioactive fallout will probably be more harmful to children of future generations than to children now living because
→
When was the world summit on sustainable development held in Johannesburg, South Africa?
→