Cancer is related to - Vidyadip

MCQ

Cancer is related to

✓
Uncontrolled growth of tissues
B
Non-malignant tumor
C
Controlled division of tissues
D
None of these

✓

Answer

Correct option: A.

Uncontrolled growth of tissues

a
It’s obvious.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "M.C.Q (0.5 Marks)" from STD 12 - 7. human health and disease→STD 12 - 7. human health and disease — all question types→BIOLOGY STD 12 Science question papers→Rajasthan Board STD 12 Science question papers→Rajasthan Board question paper generator→

Similar questions

For net primary productivity energy captured is

Among the following characters, which one was not considered by Mendel in his experiments on pea?

Which of the following is responsible for malaria?

The primary cause behind rapidly growing population of the world in recent times is

The formation of a male child depends on the sperms because

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?

Use of spermicidal creams, jellies and foams along with diaphragms, cervical caps and vaults leads to

Person having genotype I^A I^B would show the blood group as AB. This is because of:

The most common site of infection in case of Chlamydia in female is

What is the population growth rate of India as per 2001 census ?