Download App

STD 12 - 11. organisms and populations — BIOLOGY STD 12 Science — Question

Rajasthan BoardEnglish MediumSTD 12 ScienceBIOLOGYSTD 12 - 11. organisms and populations1 Mark
MCQ
Carrying capacity is
  • A
    the capacity of an individual to produce young ones
  • ✓
    availability of resources in a given habitat to support a certain no of individuals of population, beyond which no further growth is possible
  • C
    gene frequency from one generation to next
  • D
    gene frequency in same generation
✓

Answer

Correct option: B.
availability of resources in a given habitat to support a certain no of individuals of population, beyond which no further growth is possible
b
Carrying capacity is the maximum number of individuals of population that can be sustained by available resources in a given habitat beyond which there is no further growth. When population reaches the carrying capacity then mortality $<$ natality.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "M.C.Q (0.5 Marks)" from STD 12 - 11. organisms and populations→STD 12 - 11. organisms and populations — all question types→BIOLOGY STD 12 Science question papers→Rajasthan Board STD 12 Science question papers→Rajasthan Board question paper generator→

Similar questions

A sequence of three bases on tRNA which binds to mRNA codon is?
→
.........in animals have the ability to transform normal cells into cancerous cells
→
Match the following. 
Column $- I$ Column $- II$
$(A)$ Ring worms $(P)$ W. malayi
$(B)$ Elephantiasis $(Q)$ Rhino virus
$(C)$ Common cold $(R)$ HIV
  $(S)$ Trichophyton
→
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
→
The Ministry of Environment and Forest has initiated Ganga action plan and Yamuna action plan
$(i)$ To save these major rivers of our country from pollution
$(ii)$ It is proposed to build a large number of sewage treatment plants
$(iii)$ Under these plans, only treated sewage may be discharged in the river
→
The factor responsible for cirrhosis of liver is
→
Hereditary diseases constitute an important factor in checking the growth of population of a small community if
→
In figs pollination done only by..............., not by any another.
→
The rupturing of graafian follicle and release of ovum is known as:
→
In an embryo sac, the cells that degenerate after fertilisation are.
→