Download App

STD 11 - 10. Cell cycle and cell division — NEET STD 11 Science — Question

Gujarat BoardEnglish MediumSTD 11 ScienceNEETSTD 11 - 10. Cell cycle and cell division4 Marks
MCQ
Choose correct pair :
  • ✓
    Telophase - $I$ $\rightarrow$ Nuclear membrane and nucleolus reappear
  • B
    Anaphase - $II$ $\rightarrow$ Chromosomes align at the equator
  • C
    Metaphase - $II$ $\rightarrow$ Splitting of the centromere of each chromosomes.
  • D
    Prophase - $II$ $\rightarrow$ Chromatids move towards opposite poles of the cell.
✓

Answer

Correct option: A.
Telophase - $I$ $\rightarrow$ Nuclear membrane and nucleolus reappear
a

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

NEET STD 11 Science question papers→Gujarat Board STD 11 Science question papers→Gujarat Board question paper generator→

Similar questions

Which one of the following is a $C_4$ plant?
→
$A$- Four cells are at the chalzal end and are called the antipodals.

$R -$ A typical angiosperm embryo sac, at maturity,though $8$-nucleate is $7$-celled

→
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

→
In a moss the sporophyte
→
The place where auxins are active is
→
The first clinical gene therapy was given for treating
→
Degeneration of $DNA$ after heating can be studied by comparing
→
Select a correct match
→
Life cycle of Funaria is not completed without water. Choose the correct statement
→
$I.$ Initial $CO _{2}$ acceptor     $II.$ Extent of photorespiration

$III.$ Enzyme catalyzing reaction that fixes $CO _{2}$    $IV.$ Presence of Calvin cycle

$V.$ Leaf anatomy

Which one does not differ in a $C_{3}$ and $C_{4}$-plants?

→