Download App

STD 11 - 13. Plant growth and development — NEET STD 11 Science — Question

Gujarat BoardEnglish MediumSTD 11 ScienceNEETSTD 11 - 13. Plant growth and development4 Marks
Question
Cytokinesis refers to
✓

Answer

b
(a)Cytokinine stimulates cellular division by hastening the transition of cell from $ G_2 $ phase to the $M-$ phase of the cell.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

NEET STD 11 Science question papers→Gujarat Board STD 11 Science question papers→Gujarat Board question paper generator→

Similar questions

Which of the following statements about enzymes is wrong ?
→
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
→
Yeast is not included in protozoans but are placed in fungi because
→
Electric charge separation or quantum conversion occurs at
→
Perianth means..........
→
Chrysan the mum ....... is modified to...... .
→
The roots of sequoia are generally...
→
In ______ placentation, the placenta forms a ridge along the ventral suture of the ovary.
→
After respiration, the conversion of energy is mainly in the form of
→
The stage between two meiotic division is called
→