Download App

Reproduction in Lower and Higher Animals — BIOLOGY STD 12 Science — Question

Maharashtra BoardEnglish MediumSTD 12 ScienceBIOLOGYReproduction in Lower and Higher Animals3 Marks
Question
Give significance: Colostrum.
✓

Answer

  1. Colostrum is the first milk which is sticky and yellowish secreted by the mammary glands soon after the parturition.
  2. Being high protein in its content, it nourishes the newly born child.
  3. The antibodies present in it helps in developing resistance for the newborn baby at a time when its own immune response is not fully developed.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "Answer the following questions in detail." from Reproduction in Lower and Higher Animals→Reproduction in Lower and Higher Animals — all question types→BIOLOGY STD 12 Science question papers→Maharashtra Board STD 12 Science question papers→Maharashtra Board question paper generator→

Similar questions

Give scientific Reson
Left ventricle is thick than all other chambers of heart.
OR
Left ventricle has thicker wall than the right ventricle.
→
A number of passengers were severely burnt beyond recognition during a train accident. Name and describe a modern technique that can help hand over the dead to their relatives.
→
What is agamospermy? How is agamospermy different from parthenogenesis and parthenocarpy?
→
(a) Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
(b) How many amino acids will be there in the polypeptide chain formed on the following mRNA ?
5' GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
→
Many plant and animal species are on the verge of their extinction because of loss of forest land by indiscriminate use by the humans. As a biology student what method would you suggest along with its advantages that can protect such threatened species from getting extinct?
→
Differentiate between in situ and ex situ approaches of conserving biodiversity.
→
Give reasons : ATP is called energy currency of the cell.
→
Why is smoking a bad habit?
→
Answer the following questions:
What is meant by ADA deficiency? How is gene therapy a solution to this problem? Why is it not a permanent cure?
→
Answer the following questions:
How does a farmer use the dormancy of seeds to his advantage?
→