Download App

STD 12 - 1. sexual reproduction in flowering plants — NEET STD 11 Science — Question

Gujarat BoardEnglish MediumSTD 11 ScienceNEETSTD 12 - 1. sexual reproduction in flowering plants4 Marks
MCQ
Identify figure.
  • A
    Typical gynoecium
  • ✓
    Typical stamen
  • C
    Cut section of microsporangium
  • D
    Flower
✓

Answer

Correct option: B.
Typical stamen
b

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

NEET STD 11 Science question papers→Gujarat Board STD 11 Science question papers→Gujarat Board question paper generator→

Similar questions

The pollination which occurs in one plant is
→
Class is placed between.........and..........in taxonomy
→
The maximum growth rate occurs in
→
Which one among the following chemical is used for causing defoliation of forest trees
→
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

→
Is some plants, the female gamete develops into embryo without fertilization. This phenomenon is known as
→
Bacterial ribosomes are present
→
Read the following statements and answer the question.

$(i)$ Some members are saprophytes or parasites while a large number of them are decomposers of litter and help in mineral cycling.

$(ii)$ They reproduce only by asexual spores known as conidia.

$(iii)$ Mycelium is septate and branched.

$(iv)$ Alternaria, Colletotrichum and Trichoderma are examples of this class. Which of the following class of fungi is being described by the above statements?

→
Which one of the following is common to multicellular fungi, filamentous algae and protonema of mosses?
→
Passage cells are present in
→