MCQ
If the $DNA$ strand has the nitrogenous base sequence $ATTGCC$, the $mRNA$ will have
- A$ATTGCA$
- B$ATCGCC$
- C$UGGACC$
- D$UAACGG$
✓
Answer
Need a full question paper?
Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.
Explore more
Similar questions
In lac operon, $z$ gene codes for:
→Vaginal orifice, urethral orifice and clitoris are protected by
Which of the following figures correctly represents the replication fork formed during $DNA$ replication
→Which of the following enzymes are used to join bits of $DNA$?
→Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
→$3$'$TACATGGCAAATATCCATTCA5'$
A human male decides to adopt a surgical method for contraception. Identify the point in the diagram where a cut would be made and tied.
The function of endothecium is
Which of the following bacteria is not a source of restriction endonuclease?
Punnett square was developed by
The green revolution succeeded in increasing the yield of crops mainly due to the use of
→$I.$ improved varieties of the crops
$II.$ Agro-chemicals
$III.$ Better management practices
Choose the correct option.