MCQ
In cold and foggy areas, the limiting factor is
- ATemperature
- BLight
- ✓Both $(a)$ and $(b)$
- DNone of the above
✓
Answer
Correct option: C.
Both $(a)$ and $(b)$
c
It’s obvious.
It’s obvious.
Need a full question paper?
Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.
Explore more
Similar questions
Chitin present in the exoskeletons of arthropods is
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
→$3$'$TACATGGCAAATATCCATTCA5'$
Change in population size equation with prolonged exponential phase can be converted into logistic growth equation by multiplying it with
Which one of the following belongs to vascular cryptogams
The essential role of air in the growth of green plants was revealed by
The population of an insect species shows an explosive increase in numbers during rainy season followed by its disappearance at the end of the season. What does this show ?
Statement I: The end walls of sieve tube elements are perforated in a sieve-like manner to form the sieve plates.
Statement II: The companion cells help in maintaining the pressure gradient in the sieve tubes.
Statement II: The companion cells help in maintaining the pressure gradient in the sieve tubes.
How many food chains are there in the food web shown above?
Modern ex situ conservation includes
Given below are two statements : One is labelled asAssertion (A) and the other is labelled as Reason (R)
Assertion (A): The growth of multicellular organism is due to mitosis
Reason (R) Mitosis is also called as reductional division and it offers genetic stability
In the light of the above statements choose the correct answer from the options given below :
Assertion (A): The growth of multicellular organism is due to mitosis
Reason (R) Mitosis is also called as reductional division and it offers genetic stability
In the light of the above statements choose the correct answer from the options given below :