In Streptococcus pneumoniae: - Vidyadip

MCQ

In Streptococcus pneumoniae:

✓
Virulent form is smooth.
B
Virulent form is rough.
C
Non virulent form is capsulated.
D
All forms are rough.

✓

Answer

Correct option: A.

Virulent form is smooth.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "M.C.Q (1 Marks)" from Molecular Basis of Inheritance→Molecular Basis of Inheritance — all question types→BIOLOGY STD 12 Science question papers→Gujarat Board STD 12 Science question papers→Gujarat Board question paper generator→

Similar questions

Stirred$-$tank bioreactors have been designed for?

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?

When huge amount of $\mathrm{CO}_2$ is dumped into a river, the $\text{BOD}$ will:

Sewage water is purified for recycling by the action of:

Select the correct sentence for colour blindness ?

Family planning programme was invented in:

Biotic potential refers to:

If meselson and stahl's experiment is continued for four generations in bacteria, the ratio of $\frac{15_\text{N}}{15_\text{N}}:\frac{15_\text{N}}{14_\text{N}}:\frac{14_\text{N}}{14_\text{N}} $containing $\text{DNA}$ in the fourth generation would be:

Appearance of vegetative propagules from the nodes of plants such as sugarcane and ginger is mainly because:

Which of the following is considered a hot-spot of biodiversity in India ?