MCQ
Layer of cells between endodermis and vascular bundles is called
  • A
    Epidermis
  • Pericycle
  • C
    Hypodermis
  • D
    Pith

Answer

Correct option: B.
Pericycle
b
(b) Pericycle is a single layered or multilayered cylinder of thin-walled or thick walled cells present between the endodermis and vascular tissues.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Similar questions

Auxins promote
The compounds that are subjected to biological oxidation are called _______ in which ______ is the most common.
Cyberviatic is associated with
Angiospermic plants are characterised by

$I.$ double fertilisation $II.$ triploid endosperm $III.$ Diploid endosperm

Choose the correct option from the following regarding above statements

Substance which is essential for the respiration as well as photosynthesis is
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

New York at $41^o\, N$ has .......... species and Greenland at $71^o\, N$ has ......... species.
The organisms found in boiling thermal springs are
A bacterium grown over medium having radioactive Sulphur incorporates radioactivity in
Mark the given statements True (T) or False (F).
(i) Aristotle was the earliest scientist to attempt a more scientific basis for classification. He used complex morphological characters to classify plants into trees. shrubs and herbs.
(ii) Fungi have cellulose in their walls while green plants have chitin in cell wall.
(iii) According to five kingdom of classification, the unicellular prokaryotic organisms were placed in kingdom protista.
(iv) The classification system is not only based on morphological, physiological and reproductive similarities, but is also phylogenetic ie. is based on evolutionary relationships.
(v) Methanogens are present in the gut of several ruminant animals such as cows and buffaloes and they are responsible for the production of methane from the dung of these animals.
(vi) In Nostoc, site of oxygen fixation is heterocysts.
(vii) Cholera, tetanus, citrus canker are well known diseases caused by different bacteria.
(viii) Bacteria reproduce mainly by fission.
(ix) The mycoplasma are organisms that completely lack a cell wall. They are smallest living cells known and can survive without oxygen.
(x) Chrysophytes, Euglenoids and Slime moulds belong to kingdom protista.
Choose the correct option given below : -