MCQ
$NPP =$
- A$GPP +R$
- B$GPP \,XR$
- ✓$GPP-R$
- D$GPPER$
✓
Answer
Correct option: C.
$GPP-R$
c
Need a full question paper?
Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.
Explore more
Similar questions
The term ‘totipotency’ refers to the capacity of a:
Mostly pesticides are
Identify the $X$ and $Y$ from given diagram
→Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
→Under certain conditions scientists have obtained cell-like structures. These are known as:
The most important component of the oral contraceptive pills is _____.
Which one of the following is the correct statement regarding the particular psychotropic drug specified?
Which of the following refer to correct example(s) of organisms which have evolved due to changes in environment brought about by anthropogentc action$?$
→$(a)$ Darwin's Finches of Galapagos islands.
$(b)$ Herbicide resistant weeds.
$(c)$ Drug resistant eukaryotes.
$(d)$ Man$-$created breeds of domesticated animals like dogs.
Utility of fungi for steroid conversion was demonstrated by:
A mutagenic pollutant is :