Overall the contribution of carbon dioxide to global warming is:

$(A)$ Some snails go into _____$(i)$_____ to avoid ____$(ii)$_____ related problems.
$(B)$ Since small animals have a ____$(iii)$___ surface area relative to their volume, they tend to lose body heat
_____$(iv)$______ when it is cold outside.
$(C)$ Next to temperature, _____$(v)$____ is the most ecologically important environmental factor.
$(D)$ Every ____$(vi)$____ the famous Keolado National Park in Rajasthan host thousands of migrating birds.
Which one of the following option gives the correct fill ups for the respective blank numbers from $(i)$ to $(vi)$ in
the statements?

→

A place where genetic material of endangered plant is kept is:

→

Wildlife is destroyed most when:

→

Stirred-tank bioreactors have advantages over shake flasks because they

→

If a human mother has ‘$O$' blood group, the foetus would die if the blood of foetus is

→

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

→