MCQ
The "master mind'' of the cell is
- AProtoplast
- BNucleolus
- ✓Nucleus
- DPlastid
Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.
| List $- I$ | List $- II$ |
| $(a)$ $S$ phase | $(i)$ Proteins are synthesized |
| $(b)$ $G_2$ phase | $(ii)$ Inactive phase |
| $(c)$ Quiescent stage | $(iii)$ Interval between mitosis and initiation of $DNA$ replication |
| $(d)$ $\mathrm{G}_{1}$ phase | $(iv)$ $DNA$ replication |
Choose the correct answer from the options given below.
$(a) -(b) -(c)- (d)$
$3$'$TACATGGCAAATATCCATTCA5'$
$I.$ The total organic matter synthesised by the producers in the process of photosynthesis per unit time and area is known as gross primary productivity
$II.$ Net primary productivity is the weight of the organic matter stored by the producers in a unit area/volume per unit time