MCQ
The "master mind'' of the cell is
  • A
    Protoplast
  • B
    Nucleolus
  • Nucleus
  • D
    Plastid

Answer

Correct option: C.
Nucleus
c
It’s obvious.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Similar questions

Match List $- I$ with List $- II.$

List $- I$ List $- II$
$(a)$ $S$ phase $(i)$ Proteins are synthesized
$(b)$ $G_2$ phase $(ii)$ Inactive phase
$(c)$ Quiescent stage $(iii)$  Interval between mitosis and initiation of $DNA$ replication
$(d)$ $\mathrm{G}_{1}$ phase $(iv)$ $DNA$ replication

Choose the correct answer from the options given below.

$(a) -(b) -(c)- (d)$

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

Which of the following statements about pteridophytes is true ?
(i) They are the first terrestrial plants to possess vascular tissues.
(ii) It found in cool, damp, shady places though some may found in sandy soil conditions.
(iii) The main plant body is a gametophytic which is differentiated into root, stem and leaves.
(iv) The sporangia produce spores by mitosis in spore mother cells.
(v) Spores germinate to give rise to prothallus.
The origin of root hairs and lateral roots is
In root the maximum growth occurs
In $C_4$ plants mesophyll cells are connected with bundle sheath cells with the help of
During dark reaction of photosynthesis
True/False

$I.$ The total organic matter synthesised by the producers in the process of photosynthesis per unit time and area is known as gross primary productivity

$II.$ Net primary productivity is the weight of the organic matter stored by the producers in a unit area/volume per unit time

How many substrate based $ATPs$ are formed if one molecule of amino acid oxidized by Amphibolic pathway
Enzymes that catalyse removal of groups from substrates by mechanism other than hydrolysis leaving double bonds.