Download App

Molecular Basis of Inheritance — BIOLOGY STD 12 Science — Question

Gujarat BoardEnglish MediumSTD 12 ScienceBIOLOGYMolecular Basis of Inheritance1 Mark
MCQ
The nucleic acid synthesis takes place in:
  • A
    5'-3' direction.
  • B
    3'-5' direction.
  • C
    Both ways.
  • D
    Any direction.
✓

Answer

  1. 5'-3' direction.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "M.C.Q (1 Marks)" from Molecular Basis of Inheritance→Molecular Basis of Inheritance — all question types→BIOLOGY STD 12 Science question papers→Gujarat Board STD 12 Science question papers→Gujarat Board question paper generator→

Similar questions

Genes $A, B$ and $C$ are linked. Genes $A$ and $B$ are more close than $A$ and $C.$ Find out the correct option for the given statements

$I.$ $A$ might be before $B$ and $C$

$II.$ $B$ might be between $A$ and $C$

$III.$ $C$ might be between $A$ and $B$

$IV.$ More crosses has occurred between $A$ and $C$ than $A$ and $B$

→
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
→
$DNA$ fingerprinting involves identifying differences in some specific regions in $DNA$ sequence, called as:
→
The extinction of passenger pigeon was due to:
→
Age of gymnosperm is
→
Regulatory proteins are the accessory proteins that interact with RNA polymerase and affect its role in transcription. Which of the following statements is correct about regulatory protein?
→
The number of base substitution possible in amino acid codons is:
→
Which one of the following statements is correct with respect to immunity ?
→
Which bacteria is more useful for gene cloning in higher plants?
→
Approximately how much of the solar energy that falls on the leaves of a plant is converted to chemical energy by photosynthesis?
→