- ARNA polymerase
- BRNA ligase
- CDNA polymerase
- DDNA ligase
Explanation:
RNA polymerase is the enzyme of transcription and synthesizes RNA using DNA template strand. It is a complex enzyme with five core subunits and a sixth sigma subunit which binds transiently to the core enzyme and positions it to promoters on the DNA.
DNA polymerase III is major polymerizing enzyme with ten types of subunits; polymerization and proofreading activities reside in its alpha and epsilon subunits, respectively. The theta, alpha and epsilon form a core polymerase with polymerization activity but lack processivity which is imparted by clamp-loading complex (two copies of tau, gamma, delta and delta prime subunits). DNA and RNA ligases have single subunit.
Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.
| | Column A | | Column B |
| i. | Lady bird | a. | Methano bacterium |
| ii. | Mycorrhiza | b. | Trichoderma |
| iii. | Biological control | c. | Aphids |
| iv. | Biogas | d. | Glomus |
$3$'$TACATGGCAAATATCCATTCA5'$