MCQ
There was no life in:
- ✓Azoic era
- BMesozoic era
- CPalaeozoic era
- DCenozoic era
✓
Answer
Correct option: A.
Azoic era
Need a full question paper?
Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.
Explore more
Similar questions
Study the figure and identify $A$ and $B$
→Out of $8$ ascospores formed in Neurospora the arrangement is $2a : 4a : 2a$ showing.
→Withdrawal symptoms of alcohol are
$A$ : Myocardial infarction can now be treated more effectively due to genetic engineering.
→$R$ : Streptokinase produced by Streptoccocus and modified by $RDT$ is used as a clot buster for removing thrombus
Cheese ripening is done by $..........:$
→Two opposite forces operate in the growth and development of every population. One of them is related to the ability to reproduce at a given rate. The force opposing to it is called:
The phenomenon of using a predator for controlling a pest is
Suppose $2000 \mathrm{~J}$ of solar energy is incident on green vegetation. On the basis of $10 \;\%$ law of Lindeman. Identify $A, B$ and $C$
→Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
→$3$'$TACATGGCAAATATCCATTCA5'$
The zone at the edge of a lake or ocean which is alternatively exposed to air and immersed in water is called: