MCQ
Vegetable eating person acts as
- Aprimary producer
- ✓primary consumer
- Csecondary consumer
- Dtertiary consumer
✓
Answer
Correct option: B.
primary consumer
b
Primary consumers in an ecosystems are herbivores, which feed directly on producer (green plants)
Primary consumers in an ecosystems are herbivores, which feed directly on producer (green plants)
Need a full question paper?
Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.
Explore more
Similar questions
Given below are pie diagrams $I$, $II$ and $III$ related to the proportionate number of species of major taxa of invertebrates, vertebrates and plants respectively. Critically study and fill in the blanks $A, B, C$ and $D$
→Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
→The production of gametes by the parents, the formation of zygotes the $F_1$ and $F_2$ plants, can be understood using
→The largest Indian poisonous snake is:
Select the correct pair
→| Column $- I$ | Column $- II$ |
| $(A)$ Physiological barrier | $(1)$ Skin |
| $(B)$ Cellular barrier | $(2)$ Macrophages |
| $(C)$ Physical barriers | $(3)$ interferons |
| $(D)$ Cytokine barriers | $(4)$ Tears |
| $(5)$ Mucus |
Which of the following National Parks is home to the famous musk deer or hangul?
Darwinian theory was unable to explain
Which of the bacterium cause the fermentation of milk and other plant products
Filaria is transmitted by
Rarely observed phenotype in population is called as: