MCQ
Vertical distribution of different species occupying different levels is called:
- AEnumeration.
- BStratification.
- CSpecies composition.
- DNone of these.
Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.
$3$'$TACATGGCAAATATCCATTCA5'$
| Column - $I$ | Column - $II$ |
| $(a)$ Bioreactor | $(i)$ Separation of DNA fragments |
| $(b)$ Electrophoresis | $(ii)$ Production of large quantities of products |
| $(c)$ $PCR$ | $(iii)$ Detection of pathogen, based on antigen-antibody reaction |
| $(d)$ $ELISA$ | $(iv)$ Amplification of nucleic acids |
Select the correct option from following: