Which of the following process occurred during cell division - Vidyadip

MCQ

Which of the following process occurred during cell division

✓
$DNA$ replication and cell growth
B
$RNA$ replication only
C
Only cell growth
D
Only $DNA$ replication

✓

Answer

Correct option: A.

$DNA$ replication and cell growth

a

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

NEET STD 11 Science question papers→Gujarat Board STD 11 Science question papers→Gujarat Board question paper generator→

Similar questions

Which of the following hormone is produced during leaf fall

Enzymes have a very narrow optima for

Identify the phases of mieosis fro the given options

Which of the following plant part is used as a explant to prepare virus free plant ?

Plants follow ...$A$... pathways in response to environment or phases of life to form different kind of structures. This ability is called ...$B$...

Complete the given statement with the correct combination of options

To remove seed dormancy, we can treat seed by using this chemical.

An alien $DNA$ is linked with the origin ofreplication, so that this alien piece of $DNA$ can replicate and multiply itself in the host organism This can also be called ......

Synergids, zygote and primary endosperm nucleus (The haploid diploid and triploid structure) of a fertilized embryo sac are sequentially in

Polymerase chain reaction is most useful in

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?