Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
NEET 2023, Medium
Download our app for free and get started
d
The sequence of coding strand is same as RNA except thymine at the place of uracil.
The sequence of coding strand is same as RNA except thymine at the place of uracil.
Template strand $\rightarrow$ 3'-TAGCTAGCTAGCTAGCTAGCTAGCTAGC-5'
Coding strand $\rightarrow$ 5'-ATCGATCGATCG ATCGATCGATCGATCG-3'
$\downarrow$ Transcription
mRNA $\rightarrow$ 5' AUCGAUCGAUCGAUCGAUCGAUCG AUCG $3 '$
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1View SolutionTriplet for inhibiting process of translation is
- 2View SolutionUnequivocal proof that DNA is the genetic material was first proposed by
- 3The $A/U$ and $G/U$ ratio in $RNA$ isView Solution
- 4$DNA$ replication is semi-conservative asView Solution
- 5View SolutionThe non-human model organisms sequenced in Human Genome project were
- 6View SolutionThe one aspect which is not a silent feature of genetic code, is its being
- 7View SolutionAdjacent nucleotides in a polynucleotide chain are joined by
- 8Eukaryotes differ from prokaryotes in the mechanism of $DNA$ replication due toView Solution
- 9View SolutionProduction of human protein in bacteria by genetic engineering is possible because
- 10$A$ : Operator gene is functional when it is not blocked by repressor.View Solution
$R$ : Regulator gene produces active protein only which acts on operon system in $E$.coli