Download App

Biodiversity and Conservation — BIOLOGY STD 12 Science — Question

Gujarat BoardEnglish MediumSTD 12 ScienceBIOLOGYBiodiversity and Conservation1 Mark
MCQ
Wildlife conservation means the protection and preservation of:
  • A
    Ferocious wild animals only.
  • B
    Wild plants only.
  • C
    Non$-$cultivated plants and non$-$domesticated animals.
  • ✓
    All the above living in natural habitat.
✓

Answer

Correct option: D.
All the above living in natural habitat.
Wildlife conservation is the strategy to protect wild plant and animal species and their habitats.
The goal of wildlife conservation is to ensure that nature will be maintained for next generations and also to recognise the importance of wildlife.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "M.C.Q (1 Marks)" from Biodiversity and Conservation→Biodiversity and Conservation — all question types→BIOLOGY STD 12 Science question papers→Gujarat Board STD 12 Science question papers→Gujarat Board question paper generator→

Similar questions

Who add organic matter to the soil andincrease its fertility ?
→
A gene showing codominance has
→
Population interactions, in which both the species get benefited:
→
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

→
Transfer of pollen grains from the anther to the stigma of the same flower. Which kind of pollination is it?
→
Haploid plants are preferred over diploids for mutation study because in haploids.
→
Which of the following would not be used in preparing recombinant $DNA$?
→
Pod character i.e. green colour in pea is
→
$RNA$ as genetic material in ............
→
Biotechnology is being used in which of the following?
→