Download App

Enhancement of Food Production — BIOLOGY STD 12 Science — Question

Maharashtra BoardEnglish MediumSTD 12 ScienceBIOLOGYEnhancement of Food Production3 Marks
Question
Write the principles of farm management.
✓

Answer

The principles of farm management are as follows:
  1. Selection of high-yielding breeds.
  2. Understanding the feed requirements of farm animals.
  3. Supply of adequate nutritional sources for the animals.
  4. Maintaining the cleanliness of environment.
  5. Maintenance of health with the help of veterinary supervision.
  6. Undertaking vaccination programmes.
  7. Development of high-yielding cross-bred varieties.
  8. Making various products and their preservation.
  9. Distribution and marketing of the farm produce.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "Answer the following questions in detail." from Enhancement of Food Production→Enhancement of Food Production — all question types→BIOLOGY STD 12 Science question papers→Maharashtra Board STD 12 Science question papers→Maharashtra Board question paper generator→

Similar questions

How do addictions like smoking, alcoholism and drug abuse contribute in causing infertility in men?
→
How did an American Company, Eli Lilly use the knowledge of r-DNA technology to produce human insulin?
→
Double fertilisation is reported in plants of both, castor and groundnut. However, the mature seeds of groundnut are non-albuminous and castor are albuminous. Explain the post-fertilisation events that are responsible for it.
→
Pituitary gland plays an important role in pregnancy and childbirth.
→
  1. Expand ELISA.
  2. Write the principle, it is based on.
  3. Mention the two methods by which infection by a pathogen can be detected using this.
→
  1. Draw a labelled schematic diagram of a replication fork showing continuous and discontinuous replication of DNA strands.
  2. State a reason why is the replication continuous and discontinuous in the diagram drawn.
→
Name the pioneer species on a bare rock. How do they help in establishing the next type of vegetation? Mention the type of climax community that will ultimately get established.
→
B-cells and T-cells.
→
(a) Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
(b) How many amino acids will be there in the polypeptide chain formed on the following mRNA ?
5' GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
→
Write any three goals of Human Genome Project.
→