Question types

STD 12 - 5. molecular basis of inheritance question types

501 questions across 1 question group — pick any mix to generate a BIOLOGY paper with step-by-step answer keys.

501
Questions
1
Question groups
5
Question types
Sample Questions

STD 12 - 5. molecular basis of inheritance questions

One sample from each question group in this chapter. Select any group above to see the full set with answer keys.

Match List $I$ with List $II$:Choose the correct answer from the options given below :
List $I$ List $II$
$A$ $RNA$ polymerase $III$ $I$ snRNPs
$B$ hline Termination of transcription $II$ Promotor
$C$ Splicing of Exons $III$ Rho factor
$D$ $TATA$ box $IV$ SnRNAs, tRNA
  • A
    $ A-III, B-II, C-IV, D-I$
  • B
    $ A-III, B-IV, C-I, D-II$
  • $A-IV, B-III, C-I, D-II$
  • D
    $A-II, B-IV, C-I, D-III$

Answer: C.

View full solution
Match List $I$ with List $II$ . 

List $I$ List $II$
$A$. Frederick Griffith $I$. Genetic code
$B$. Francois Jacob and Jacque Monod $II$. Semi-conservative mode of DNA replication
$C$. Har Gobind Khorana $III$. Transformation
$D$. Meselson and Stahl $IV$. Lac operon

Choose the correct answer from the options given below: 

  • $A-III, B-IV, C-I, D-II$
  • B
    $A-II, B-III, C-IV, D-I$
  • C
    $A-IV, B-I, C-II, D-III$
  • D
    $A-III, B-II, C-I, D-IV$

Answer: A.

View full solution
The lactose present in the growth medium of bacteria is transported to the cell by the action of
  • A
    Acetylase
  • Permease
  • C
    Polymerase
  • D
    Beta-galactosidase

Answer: B.

View full solution
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

  • A
    $5'AUGUAAAGUUUAUAGGUAAGU3'$
  • B
     $5'AUGUACCGUUUAUAGGGAAGU3'$
  • C
    $5'ATGTACCGTTTATAGGTAAGT3'$
  •  $5'AUGUACCGUUUAUAGGUAAGU3'$

Answer: D.

View full solution
A transcription unit in $DNA$ is defined primarily by the three regions in $DNA$ and these are with respect to upstream and down stream end;
  • A
    Structural gene, Transposons, Operator gene
  • B
     Inducer, Repressor, Structural gene
  • Promotor, Structural gene, Terminator
  • D
    Repressor, Operator gene, Structural gene

Answer: C.

View full solution

Generate a STD 12 - 5. molecular basis of inheritance paper free

Pick question groups from the list above, set marks and difficulty, and export a branded PDF with step-by-step answer keys. First 3 chapters free — no signup.

Download App