Choose correct pair.
| Column $– I$ | Column $– II$ |
| $(A)\; AUG$ | $(1)$ Phenyl alanine |
| $(B) \;UAA$ | $(2)$ Methionine |
| $(C)\;UUU$ | $(3)$ Tryptophan |
| $(D) \;UGG$ | $(4)$ Stop |
Medium
Download our app for free and get started
b
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1Matching sequence of $DNA$ between two evidences, one of the criminal with the suspect is known as:View Solution
- 2View SolutionThe chemical nature of chromosome is as follows
- 3Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?View Solution
$3$'$TACATGGCAAATATCCATTCA5'$
- 4View SolutionWhich is not correctly matched
- 5View SolutionWhich one of the following does not follow the central dogma of molecular biology?
- 6The process that preserves the distribution of $DNA$ fragments in the gel while creating replica on the filter is one of the followingView Solution
- 7View SolutionOne codon codes for only one amino acid, hence the code is
- 8View SolutionMark the correct match.
- 9View SolutionWhat is the first step in Southern Blotting technique?
- 10$DNA$ fingerprinting refers toView Solution