Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
NEET 2024, Medium
Download our app for free and get started
d
Template $DNA$ is :
Template $DNA$ is :
$3'TACATGGCAAATATCCATTCA 5'$
$5' AUGUACCGUUUAUAGGUAAGU 3' m -RNA$
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1View SolutionWhich one of the following pairs is correctly matched with regard to the codon and the amino acid coded by it ?
- 2View SolutionIn the lactose operon of Escherichia coli, what is the function of promoter
- 3View SolutionWhich is stop codon?
- 4View SolutionAt what level gene expression does not occur ?
- 5In a given $DNA$ segment $ATGACC\ AGG\ ACC\ CCA\ ACA$, the first base gets mutated. The effect of this on coding by this $DNA$ segment will result inView Solution
- 6The reason for double helical structure of $DNA$ is operation ofView Solution
- 7Eukaryotic $RNA$ polymerase $III$ catalyse the synthesis ofView Solution
- 8View SolutionWhich one of the following pairs is correctly matched
- 9View SolutionWhich enzyme plays important role in transcription
- 10View SolutionA child receives