Cowper's glands are found in. - Vidyadip

MCQ

Cowper's glands are found in.

A
Male mammals
B
Female mammals
C
Male amphibians
D
Female amphibians

✓

Answer

Male mammals

Explanation:

Cowper's gland is also known as bulbourethral gland.

It is an exocrine gland present in male reproductive system.

It provides lubrication to the distal urethra and neutralize the acidic urine which is present in the urethra.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "M.C.Q (0.5 Marks)" from Human Reproduction→Human Reproduction — all question types→BIOLOGY STD 12 Science question papers→Rajasthan Board STD 12 Science question papers→Rajasthan Board question paper generator→

Similar questions

Through which cell of the embryo sac, does the pollen tube enter the embryo sac?

The development of fruits without fertilisation of the ovary, is called:

Somatic hybrids are produced by

Natality refers to.

Tabacco chewing results in:

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

Which of the following is correct for $r$-selected species?

Pleiotropic effect is found in:

Which of the following secretes large amount of progesterone ?

The biotic interaction between two species in which one is benefitted and the other is not harmed, is called: