Given below are two statements:
Statement $I:$ $RNA$ mutates at a faster rate.
Statement $II$: Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the correct answer from the options given below:
NEET 2023, Medium
Download our app for free and get started
a
RNA being unstable, mutate at a faster rate. Consequently, viruses having RNA genome and having shorter life span mutate and evolve faster.
RNA being unstable, mutate at a faster rate. Consequently, viruses having RNA genome and having shorter life span mutate and evolve faster.
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1View SolutionSelect the correct statement regarding protein synthesis.
- 2View SolutionWhich is not correctly matched
- 3Consider the followingView Solution
1.Structural gene
2.Messenger $RNA$
3.Ribosomes
4.Transcription
5.Translation
Which of the following is the correct sequence for protein synthesis
- 4View SolutionGenes are chemically
- 5$UUU$ code forView Solution
- 6Which of the following is correct for $m-RNA$ in eukaryotes ?View Solution
- 7View SolutionWhich one of the following statements about Histones is wrong?
- 8The length of a helix of $DNA$ isView Solution
- 9View SolutionWhich of the following is nongenetic, which is utilised for protein synthesis
- 10Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?View Solution