In Escherichia coli, lac operon is induced by
Medium
Download our app for free and get started
a
The inducer for Lac operon of Escherichia coli is lactose (actually allolactose or metabolite of Lactose). This lac operon normally remains inactive. When lac operon contacts with lactose, the lactose acts as an inducer and combines with the repressor, and the repressor is detached from operator gene. Thus $RNA$ - repressor, and the repressor is detached from operator gertural genes and polymerase enzyme gets its passage and reaches to the structural starts the transcription.
The inducer for Lac operon of Escherichia coli is lactose (actually allolactose or metabolite of Lactose). This lac operon normally remains inactive. When lac operon contacts with lactose, the lactose acts as an inducer and combines with the repressor, and the repressor is detached from operator gene. Thus $RNA$ - repressor, and the repressor is detached from operator gertural genes and polymerase enzyme gets its passage and reaches to the structural starts the transcription.
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1$A$ : Operator gene is functional when it is not blocked by repressor.View Solution
$R$ : Regulator gene produces active protein only which acts on operon system in $E$.coli - 2View SolutionWhich is the hereditary material in bacteria
- 3View SolutionGenetic information transfer nucleus to cytoplasm by
- 4Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?View Solution
$3$'$TACATGGCAAATATCCATTCA5'$
- 5View SolutionWhich one of the following group of codons is called as degenerate codons ?
- 6View SolutionWhich of the following is not a property of the genetic code?
- 7In tailing, adenylate residues are added at $3'$ endView Solution
- 8Poly $A$ tail is present inView Solution
- 9View SolutionIn the lactose operon of Escherichia coli, what is the function of promoter
- 10Select the correct option.Direction of Direction of reading of $RNA$ synthesis the template $DNA$ strandView Solution
Direction of $RNA$ synthesis Direction of reading of the template $DNA$ $(a)$ $5'-3'$ $3'-5'$ $(b)$ $3'-5'$ $5'-3'$ $(c)$ $5'-3'$ $5'-3'$ $(d)$ $3'-5'$ $3'-5'$