Download App

STD 12 - 8. microbes in human welfare — BIOLOGY STD 12 Science — Question

Gujarat BoardEnglish MediumSTD 12 ScienceBIOLOGYSTD 12 - 8. microbes in human welfare1 Mark
MCQ
$IPM $ (Integrated Pest Management) involves
  • ✓
    Biological control
  • B
    Pesticides
  • C
    Confusion technique
  • D
    Biofertilizers
✓

Answer

Correct option: A.
Biological control
a
It’s obvious.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "M.C.Q (1 Marks)" from STD 12 - 8. microbes in human welfare→STD 12 - 8. microbes in human welfare — all question types→BIOLOGY STD 12 Science question papers→Gujarat Board STD 12 Science question papers→Gujarat Board question paper generator→

Similar questions

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

→
The pathogens of genera, Microsporum, Trichophyton and Epidermorphyton are responsible for:
→
Genetic equilibrium means
→
Which one of the following statements is correct?
→
Filariasis is caused by:
→
An example of gene therapy is
→
Which one of the following is not a male accessory gland?
→
The enzymes, commonly used in genetic engineering are
→
In the case of a couple where a man is having very low sperm count, which of the following technique will be the most suitable for fertilization?
→
Which disease is genetically linked
→