Larger sub-unit of ribosome is composed of how many $rRNA$ molecules
Medium
Download our app for free and get started
b
It's Obvious
It's Obvious
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1View SolutionAt what level gene expression does not occur ?
- 2If the distance between two consecutive base pairs is $0.34\, nm$ and the total number of base pairs of a $DNA$ double helix in a typical mammalian cell is $6.6 \times 10^{9}$ $bp,$ then the length of the $DNA$ is approximatelyView Solution
- 3Exon part of $m-RNAs$ has code forView Solution
- 4View SolutionWhich one of the following does not follow the central dogma of molecular biology?
- 5Semiconservative replication of $DNA$ was first demonstrated inView Solution
- 6Removal of $RNA$ polymerase $I$ from nucleoplasm will affect the synthesis ofView Solution
- 7Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?View Solution
$3$'$TACATGGCAAATATCCATTCA5'$
- 8The diagram shows an important concept in the genetic implication of $DNA$. Fill in the blanks $A$ to $C$.View Solution
- 9View SolutionInformation flow or central dogma of modern biology is
- 10If there are $81\; million$ bases in $RNA$ of human cell, then calculate the total number of introns present in $cDNA$View Solution