Methyl guanosine triphosphate is added at $5 '$ end of hn-$RNA$ in a process of
Medium
Download our app for free and get started
c
In capping, unusual nucleotide (methyl guanosine triphosphate) is added to $ 5 $' end of $hn$-$RNA$ and forms cap. $CCA$ segment is also added to t-$RNA$ as terminal addition for specific function.
In capping, unusual nucleotide (methyl guanosine triphosphate) is added to $ 5 $' end of $hn$-$RNA$ and forms cap. $CCA$ segment is also added to t-$RNA$ as terminal addition for specific function.
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1View SolutionWhich of the following is incorrect for Heryshey - chase experiment ?
- 2Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?View Solution
- 3View SolutionSmallest structure having the power of replicating itself is
- 4How many amino acids will be coded by the $mRNA$ sequence $-5$ $'CCCUCAUAGUCAUAC3'$ if a adenosine residue is inserted after $12^{th}$ nucleotide?View Solution
- 5Assertion : $DNA$ is associated with proteins.View Solution
Reason : $DNA$ binds around histone proteins that form a pool and the entire structure is called a nucleosome.
- 6View SolutionThe regulatory genes are located
- 7View SolutionSouthern blotting is done for
- 8$DNA$ multiplication is calledView Solution
- 9Which of the following $rRNAs$ acts as structural $RNA$ as well as ribozyme in bacteria?View Solution
- 10Antiparallel strands of a $DNA$ molecule means thatView Solution