One functional unit of gene which specifies synthesis of one polypeptide is known as
Medium
Download our app for free and get started
d
It's Obvious
It's Obvious
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1View SolutionPortion of gene which is transcribed but not translated is
- 2View SolutionAssumption that genetic code is a triplet was suggested by
- 3View SolutionIdentify the incorrect statement.
- 4Semiconservative replication of $DNA$ was first demonstrated inView Solution
- 5Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?View Solution
- 6$A$ : $c-DNA$ libraries are important to scientists in human genomics.View Solution
$R$ : $c-DNA$ is synthetic type of $DNA$ generated from $mRNA$ - 7View SolutionWhich of following is not salient feature of human genome ?
- 8View SolutionThe vector for genetic code is called
- 9Degeneration of $DNA$ after heating can be studied by comparingView Solution
- 10The diagram shows an important concept in the genetic implication of $DNA$. Fill in the blanks $A$ to $C$.View Solution
