One functional unit of gene which specifies synthesis of one polypeptide is known as
Medium
Download our app for free and get started
d It's Obvious
Download our app
and get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?