Synthesis of $m - RNA$ is
Medium
Download our app for free and get started
a
(a)Transcription is the process of the formation of $RNA$ from $DNA$ template.
(a)Transcription is the process of the formation of $RNA$ from $DNA$ template.
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1View SolutionThe process of genetic mutation is
- 2Assertion : “ $DNA$ finger printing” has become a powerful tool to establish paternity and identity of criminals in rape and assault cases.View Solution
Reason : Trace evidences such as hairs, saliva and dried semen are adequate for $DNA$ analysis.
- 3Eukaryotic $RNA$ polymerase $III$ catalyse the synthesis ofView Solution
- 4View SolutionRepressor protein is formed from
- 5View SolutionThe genes are responsible for growth and differentiation in an organism through regulation of
- 6View SolutionOperon is a
- 7$GUU$ codes forView Solution
- 8Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?View Solution
$3$'$TACATGGCAAATATCCATTCA5'$
- 9View SolutionIn the lac operon, the structural genes are switched off when
- 10View SolutionIn split genes, the coding sequences are called