The association of histone $H_1$ with a nucleosome indicates that
NEET 2017, Medium
Download our app for free and get started
b
(b) : Histones help in packaging of $DNA$. In eukaryotes, $DNA$ packaging is carried out with the help of positively charged basic proteins called histones. Histones are of five types -$H_1, H_2A, H_2B,H_3$ and $H_4$. $H_1$ is attached over the linker $DNA$. Histone contains a large proportion of the positivelycharged (basic) amino acids, lysine and arginine in their structure. $DNA$ is negatively charged due to the phosphate groups on its backbone. The result of these opposite charges is strong attraction and therefore, high binding affinity between histones and $DNA$.
(b) : Histones help in packaging of $DNA$. In eukaryotes, $DNA$ packaging is carried out with the help of positively charged basic proteins called histones. Histones are of five types -$H_1, H_2A, H_2B,H_3$ and $H_4$. $H_1$ is attached over the linker $DNA$. Histone contains a large proportion of the positivelycharged (basic) amino acids, lysine and arginine in their structure. $DNA$ is negatively charged due to the phosphate groups on its backbone. The result of these opposite charges is strong attraction and therefore, high binding affinity between histones and $DNA$.
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1View SolutionWhich one process is only concerned with the transcription
- 2View SolutionWhich one of the following is called polynucleotide joining enzyme
- 3View SolutionThe drug streptomycin inhibits the process of
- 4The diagram shows an important concept in the genetic implication of $DNA$. Fill in the blanks $A$ to $C$.View Solution
- 5Which of following is not correct option for $t-RNA$?View Solution
- 6Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?View Solution
- 7$DNA$ replication is semi-conservative asView Solution
- 8Semiconservative replication of $DNA$ was first demonstrated inView Solution
- 9View SolutionGenes that are involved in turning on or off the transcription of a set of structural genes are called
- 10Allelic sequence variations where more than one variant (allele) at a locus in a human population with a frequency greater than $0.01$ is refered to asView Solution