Which of the following statement is incorrect?
Medium
Download our app for free and get started
d
$DNA$ fingerprinting involves identifying differences in repetitive $DNA$. Since the $DNA$ from every tissue of an individual show the same degree of polymorphism, they become very useful identification tool in forensic application.
$DNA$ fingerprinting involves identifying differences in repetitive $DNA$. Since the $DNA$ from every tissue of an individual show the same degree of polymorphism, they become very useful identification tool in forensic application.
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1View SolutionIn lac operon model; repressor protein binds to which site
- 2View SolutionA molecule that can act as a genetic material must fulfill the traits given below, except
- 3View SolutionIdentify the correct pair.
- 4View SolutionWhich of the following are salient features of genetic code ?
- 5View SolutionWhich one of the following pairs is correctly matched with regard to the codon and the amino acid coded by it ?
- 6View SolutionWhich of the following is not a property of the genetic code?
- 7Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?View Solution
$3$'$TACATGGCAAATATCCATTCA5'$
- 8Identify the following point mutations in $mRNA : UAU\ ACC\ UAU$ to $UAU\ AAC\ CUA$ and $UUG\ CUA\ AUA$ to $UUG\ CUG\ AUA$View Solution
- 9In a given $DNA$ segment the number of nucleotides of guanine is $75$ and those of thymine is $75$. The total number of nucleotides in the segment will beView Solution
- 10In biological systems, the $RNA$ molecules direct the synthesis of specific proteins which are characteristics of each kinds of organism. This process is known asView Solution