Which enzyme plays important role in transcription
Medium
Download our app for free and get started
a
It's Obvious
It's Obvious
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1Transcription of $DNA$ is aided byView Solution
- 2Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?View Solution
- 3View SolutionUridine is formed when pyrimidine nitrogen base uracil joins with
- 4Watson and Crick are known for their discovery that $DNA$View Solution
- 5Which of the following statements about $RNA$ polymerase are correct?View Solution
$i. \;RNA\; polymerase \;I \;transcribes \;rRNAs$.
$ii. \;RNA \;polymerase \;II \;transcribes \;snRNAs.$
$iii. \;RNA \;polymerase \;III \;transcribes \;hnRNA.$
$iv. \;RNA \;polymerase \;II \;transcribes \;hnRNAs.$
- 6Identify the following point mutations in $mRNA : UAU\ ACC\ UAU$ to $UAU\ AAC\ CUA$ and $UUG\ CUA\ AUA$ to $UUG\ CUG\ AUA$View Solution
- 7Which is the basis of genetic mapping of human genome as well as $DNA$ finger printing?View Solution
- 8View SolutionA technology, which has found immense use in solving cases of disputed parentage, is
- 9Eukaryotic $RNA$ polymerase $III$ catalyse the synthesis ofView Solution
- 10View SolutionWhich one of the following does not follow the central dogma of molecular biology?