E. coli has only $4.6 \times 10^{6}$ base pairs and completes the process of replication within 18 minutes; then the average rate of polymerisation is approximately
NEET 2020, Easy
Download our app for free and get started
b
The average rate of polymerisation of $DNA$ in E.coli is $2000$ bp per second. It has only $4.6 \times 10^{6}$ bp and completes the process of replication within $18$ minutes
The average rate of polymerisation of $DNA$ in E.coli is $2000$ bp per second. It has only $4.6 \times 10^{6}$ bp and completes the process of replication within $18$ minutes
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1The haploid content of human $DNA$ isView Solution
- 2Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?View Solution
$3$'$TACATGGCAAATATCCATTCA5'$
- 3View SolutionTransformation was discovered by
- 4Assertion : $UAA,\,UAG$ and $UGA$ terminate protein synthesis.View Solution
Reason : They are not recognised by $tRNA$.
- 5The successive nucleotides of $RNA$ are covalently linked through or antiparallalView Solution
- 6Which of the following statements are correct?View Solution
$i. r-RNA$ provides the template for synthesis of proteins.
$ii.$$ t-RNA$ brings amino acids and reads the genetic code.
$iii. $$RNA$ polymerase binds to promoter and initiates transcription.
$iv. $A segment of $DNA$ coding for polypeptide is called intron.
- 7View SolutionThe equivalent of a structural gene is
- 8If there are $81\; million$ bases in $RNA$ of human cell, then calculate the total number of introns present in $cDNA$View Solution
- 9Which form of $RNA$ has a structure resembling clover leafView Solution
- 10View SolutionThe vector for genetic code is called