Given below are two statements :
Statement $I:$
DNA polymerases catalyse polymerisation only in one direction, that is $5^{\prime} \rightarrow 3^{\prime}$
Statement $II:$
During replication of $DNA$, on one strand the replication is continuous while on other strand it is discontinuous.
In the light of the above statements, choose the correct answer from the options given below :
NEET 2022, Medium
Download our app for free and get started
a
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1View SolutionWild type E.coli cells are growing in normal medium with glucose. They are transferred to a medium containing only lactose as the sugar. Which one of the following changes take place
- 2The element absent in $RNA$ isView Solution
- 3In sea urchin $DNA$, which is double stranded, $17\%$ of the bases were shown to be cytosine.The percentages of the other three basesexpected to be present in this $DNA$ areView Solution
- 4Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?View Solution
$3$'$TACATGGCAAATATCCATTCA5'$
- 5Synthesis of $m - RNA$ isView Solution
- 6View SolutionOperon is a
- 7View SolutionWhich one of the following pairs is correctly matched with regard to the codon and the amino acid coded by it ?
- 8View SolutionAssumption that genetic code is a triplet was suggested by
- 9View SolutionWhich one of the following is common to both prokaryotes and eucaryotes
- 10View SolutionOperon is