Select the two correct statements out of the four $(i-iv)$ given below about lac operon.
$i.$ Glucose or galactose may bind with the repressor and inactivate it.
$ii.$ In the absence of lactose, the repressor binds with the operator region.
$iii.$ The z-gene codes for permease.
$iv.$ This was elucidated by Francois Jacob and Jacque Monod.
Medium
Download our app for free and get started
c
Jacob and Monod proposed the lac operon of $E. coli.$ The lac operon contains a promoter, an operator, and three structural genes called $\mathrm{Z}, \mathrm{Y}$, and $\mathrm{A}$, coding for the enzyme, $b$ galactosidase, permease and transacetylase respectively. The lac regulator gene, designated as i gene, codes for repressor. In the absence of the inducer, the repressor binds to the lac operator, preventing $RNA$ polymerase from binding to the promoter and thus transcribing the structural gene.
Jacob and Monod proposed the lac operon of $E. coli.$ The lac operon contains a promoter, an operator, and three structural genes called $\mathrm{Z}, \mathrm{Y}$, and $\mathrm{A}$, coding for the enzyme, $b$ galactosidase, permease and transacetylase respectively. The lac regulator gene, designated as i gene, codes for repressor. In the absence of the inducer, the repressor binds to the lac operator, preventing $RNA$ polymerase from binding to the promoter and thus transcribing the structural gene.
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1View SolutionArrange them on the basis of increasing size:
- 2View SolutionDuring elongation of polypeptide chain, sigma factor is
- 3$NHC$ structural proteins areView Solution
- 4Purines of $DNA$ are represented byView Solution
- 5In lac operon, $z$ gene codes for:View Solution
- 6Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?View Solution
- 7View SolutionGenetically active area of chromosome is called
- 8View SolutionThe bacterial genome contains
- 9View SolutionGriffith have performed series of experiments on
- 10View SolutionThe genes are responsible for growth and differentiation in an organism through regulation of