The final proof for $DNA$ as the genetic material came from the experiments of
NEET 2017, Medium
Download our app for free and get started
a
(a)
(a)
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1Escherichia coli fully labelled with $15 \mathrm{~N}$ is allowed to grow in $14 \mathrm{~N}$ medium. The two strands of $DNA$ molecule of the first generation bacteria haveView Solution
- 2View SolutionAnticodon is
- 3Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?View Solution
$3$'$TACATGGCAAATATCCATTCA5'$
- 4In capping .......... is added to the $5'$ end of hn $RNA$View Solution
- 5What is meant by monocistronic $mRNA$View Solution
- 6View SolutionBelow experiment of
- 7Nucleotide pairs present in one turn of $DNA$ helixView Solution
- 8$DNA$ replicates semiconservatively, It was experimentally performed by.View Solution
- 9View SolutionSelf replication is occurred in
- 10$DNA$ is found primarilyView Solution