Uridine is formed when pyrimidine nitrogen base uracil joins with
Medium
Download our app for free and get started
d
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1How many amino acids will be coded by the $mRNA$ sequence $-5$ $'CCCUCAUAGUCAUAC3'$ if a adenosine residue is inserted after $12^{th}$ nucleotide?View Solution
- 2The unequivocal proof of $DNA$ as the genetic material came from the studies on aView Solution
- 3Arrangement of $DNA$ has the triplet base sequence $AAC\ GAC\ AGC\ GGC\ ACA\ AAA$. Due to mutation, the first base only got deleted. Then the likely effect of this on the coding of the $DNA$ segment is thatView Solution
- 4$DNA$ was first discovered byView Solution
- 5View SolutionWhich of the following is not correct for molecule acting as genetic material ?
- 6$DNA$ replication is aided byView Solution
- 7View SolutionWhich is stop codon?
- 8View SolutionWhich of the following molecule contains the genetic code?
- 9Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?View Solution
- 10Assertion : Replication and transcription occur in the nucleus but translation takes place in the cytoplasm.View Solution
Reason : $mRNA$ is transferred from the nucleus into cytoplasm where ribosomes and amino acids are available for protein synthesis.