Which of the following statements is correct$?$
NEET 2020, Easy
Download our app for free and get started
b
Adenine pairs with thymine through two $H -$bonds
Adenine pairs with thymine through two $H -$bonds
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1View SolutionWhat is correct for bacterial transcription?
- 2View SolutionAssertion : Comparative biochemistry provides a strong evidence in favour of common ancestory of living beings.
Reason : Genetic code is universal. - 3View SolutionWhich one of the following statements about Histones is wrong?
- 4View SolutionNucleoide is present in
- 5View SolutionWhat are the structures called that give an appearance as ‘beadsonstring’ in the chromosomes when viewed under electron microscope?
- 6In $DNA$ if $10\%$ guanine is present, how much thymine is presentView Solution
- 7If the $DNA$ codons are $ATG\ ATG\ ATG$ and a cytosine base is inserted at the beginning, which of the following will resultView Solution
- 8Which of following is not correct option for $t-RNA$?View Solution
- 9Methyl guanosine triphosphate is added at $5 '$ end of hn-$RNA$ in a process ofView Solution
- 10Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?View Solution
$3$'$TACATGGCAAATATCCATTCA5'$