Which is the "Only enzyme" that has "Capability" to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes?
NEET 2021, Medium
Download our app for free and get started
b
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1View SolutionTriplet codon in genetics is
- 2View SolutionIn the process of transcription sigma factor is important for
- 3Satellite $DNA$ is important because itView Solution
- 4View SolutionTranscription
- 5$A$ : Polypeptide sequences are dictated by $DNA$ and represented by $mRNA$.View Solution
$R$ : Sequence of amino acids in a polypeptide can be predicted by the exact sequence of nucleotides on the $mRNA$ and template $DNA$ - 6In which type of $DNA$ replication of the two newly formed molecules one is purely a new one and the other one is oldView Solution
- 7In biological systems, the $RNA$ molecules direct the synthesis of specific proteins which are characteristics of each kinds of organism. This process is known asView Solution
- 8View SolutionWhich of the following is not correct
- 9Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?View Solution
$3$'$TACATGGCAAATATCCATTCA5'$
- 10View SolutionThe genes are responsible for growth and differentiation in an organism through regulation of