Which of the following are all Nucleotides
AIIMS 2019, Medium
Download our app for free and get started
b
The building blocks of nucleic acids are referred to as nucleotides. Adenylic acid, cytidilic acid, and guanylic acid are the nucleotides found in deoxyribonucleic acid (DNA).
The building blocks of nucleic acids are referred to as nucleotides. Adenylic acid, cytidilic acid, and guanylic acid are the nucleotides found in deoxyribonucleic acid (DNA).
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1View SolutionNucleotides are building blocks of nucleic acids. Each nucleotide is a composite molecule formed by
- 2View SolutionWhat is not true for genetic code?
- 3View SolutionProperty of a codon for always coding a specific amino acid is called
- 4$A$ : $HGP$ was completed in $2003$ by sequencing all genes of all chromosomes.View Solution
$R$ : All coding and noncoding genes were sequenced by $ESTs$ - 5View SolutionMutations which alter nucleotide sequence within a gene are called
- 6View SolutionTransformation was discovered by
- 7The element absent in $RNA$ isView Solution
- 8The figure gives an important concept in the genetic implication of $DNA$. Fill the blanks $A, B$ and $C$.View Solution
- 9Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?View Solution
$3$'$TACATGGCAAATATCCATTCA5'$
- 10What is the role of $RNA$ polymerase $III$ in the process of transcription in eukaryotes?View Solution