: Choose incorrect sentence for $RNA$.
Medium
Download our app for free and get started
c
Download our appand get started for free
Experience the future of education. Simply download our apps or reach out to us for more information. Let's shape the future of learning together!No signup needed.*
Similar Questions
- 1Assertion : $UAA,\,UAG$ and $UGA$ terminate protein synthesis.View Solution
Reason : They are not recognised by $tRNA$.
- 2View SolutionIn Streptococcus pneumoniae
- 3In his experiments on the chemistry of $DNA$, Chargaff estimated the base composition of human sperms and found that Adenine constituted $31\%$ and Guanine $19\%$. The quantity of Cytosine in the $DNA$ of human somatic cell is likely to beView Solution
- 4$SNP$ which is pronounced as $"snips"$ stands forView Solution
- 5Exon part of $m-RNAs$ has code forView Solution
- 6View SolutionUridine is formed when pyrimidine nitrogen base uracil joins with
- 7Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?View Solution
- 8Which of the following figures correctly represents the replication fork formed during $DNA$ replicationView Solution
- 9$A$ - The process of splicing represents the dominance of $RNA$ word.View Solution
$R$ - The presence of introns is reminiscent of antiquity.
- 10View SolutionWhich of the following is nongenetic, which is utilised for protein synthesis